WHO, World Bank, Gates foundation Hacked

Blast the other 3, fuck it, post that shit. Do all the fucking Science.
I actually would wait for your blasting of the other 3. Then you will realize that they don't have streps. In fact HIV is the only one in common for all 4 segments. If I got some time I can guestimate a p value for that. Oh, people like to point out that it's not 4 segments but two if you compare to RaTG13. There are people in the field saying that Dr. Shi admitted herself that there is no actual virus left in her lab when asked for it; all she got is sequence. My friend working at HMS actually has a non-nefarious explanation for the insertions: your average virus lab uses so much adeno- vectors that the air and benches are all filled with their dead segments. Most of the time people don't use actual virus for experiments but simply the full length RNA/DNA wrapped in their envelop. Those constructs eat a lot of shit from the environment that's why you can always find adeno segments in them.

ALLRIGHTY THEN! Ah new day, hearing birds cheep every morning since lockdown was really nice. Pity fuckers decided it was a good time to bring the heavy machinery for maintenance today! I'll miss that.
So, reminder, we're debunking this indian paper: https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1.full which claimed to find 4 sequences common between corona and HIV.

I analized the 4th first because it's on it's own protein according to the paper, namely the HIV-1 Gag protein. And ain't that a coincidence, I also gag whenever I hear this fucking bit of conspiracy. Here's the 4th insert analysis for ya:

Very funny. And the email idiots so far are quoting air, forum posts with no backing, and emails with boomer paswords. But fuck it, you're right, I misremembered which idiot he was BLASTing there, sorry for that one, hell I didn't even remember a non-HIV idiot, either way. I'm fairly sure we did have the HIV shit redebunked here. But I'll BAST it again here myself. Or more concretely I'll blast insert 4. If you want I'll go after the other three later, right now I have to exercize.

So here's the original paper: https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1.full

if you check:
F7.large.jpg

inserts are the parts in black. So paper claims insert 4 is analogous to HIV. That is: "CAGACTAATT CTCCTCGGCG GGCA", alright, first off let's check where it is. If you go to the sequence because their figures are shit:
Ver archivo adjunto 1248223
that's 23592 to 23625, BLAST THAT SHIT, also remember to tell BLAST to ignore SARS-COV2 else it'll just tell you SARS COV2 has 100% analogy. Yes that's even if you use BLAST straight from the ncbi page, it doesn't remember where it comes from like that. Just put those numbers in the range sarscov2 in the specimen and tell it to blast:
Ver archivo adjunto 1248222
Well that's awkward, no relevant sequences at all. Go back and tell it to blastn so it'll check for more shit.
Ver archivo adjunto 1248226
WOULD YOU LOOK AT THAT. 13 (edit: ORGANISMS (God I'm dumb))AND NONE OF THEM ARE HIV. The indians fucked up. Because they're streetshitters. And that's why the non-peer-reviewed paper got assblasted to hell and back as soon as it got peer reviewed. Voila! Every idiot quoting this shit, nobel price or not, can get fucked.

If you want later today I'll blast the other 3. But suffice it to say, it's the same fucking result. THIS SHIT'S BUNK.

So now it's time to analize one two and three, which I wanted to analyze together because, and I quote:

"The amino acid residues of inserts 1, 2 and 3 of 2019-nCoV spike glycoprotein that mapped to HIV-1 were a part of the V4, V5 and V1 domains respectively in gp120 "

So we'll do something special. Namely use the tool to analyze multiple inserts simultaneously, because if I am gonna take the time and autism to analyze this shit, I might as well dance on the god damned grave! Also, since you asked for it. I'll also analyze all 4 of them together, just for the hell of it. But first some structure. First I will post the code of the insert, since the original paper only gives it on the images for some reason. Next I will put the screencap of it on the original genome, namely on this link: https://www.ncbi.nlm.nih.gov/nuccore/MN908947 so you can see it is indeed there. This also gives me the number of the bp, because for some reason the original paper doesn't tell us. More importantly it lets me corroborate that I got the right sequence, so I'll put it throught BLAST. Then I'll put the screenshot of BLAST, first megablast, then blastn (which analyzes for a wider range. Megablast is to find the organism, blastn to find similar sequences. And you also get my comentary because I am hilarious and witty. And that was totally not sarcasm. Alright? Alright!

So, Insert 1 time, that is "GGGACCAATGGTACTAAGAGG" And if we check the genes we get this is from 21776 to 21796.

ins1 code.jpg


So let's get crackin' cause this show ain't stoppin'! DROP THAT BLAST!

ins1 mega.jpg


Oh hey what a surprise the only results of megablast are SARS COV 2. Oh btw WHO, it's SARS-CoV2, not COVID19, GET IT RIGHT! Blastn incoming!
ins1 blastn.jpg

Well that's awkward. 100% confirmation with an artificial spike protein. This one: https://www.ncbi.nlm.nih.gov/nucleo...k&log$=nuclalign&blast_rank=1&RID=A2S0VD1Y016 But that's just a small amount of bases out of the whole damned construct. So let's actually get that protein and BLAST IT!
ARTIFICIAL CONSTRUCT.jpg


ALRIGHT SO I FREAKED OUT BECAUSE I'M A MORON. I'mma leave the original rant here so you see how stupid I am. And then let me tell you a little secret:

Holy. mother. of god. And the rest of the 100 results is all versions of SARS-CoV2 too. You can BLAST it yourself if you want. Alright this is where I call everyone (I put here a bunch of users that don't deserve to be harassed by the tons of notifications from every time I edit this shit.) I need reinforcements here! that is a 100% confirmation between the whole genome of an artificial protein and multiple versions of SARS-Cov2, and over 98% for the rest. I'm not joking here this is red fucking alert THIS, THIS IS HOW YOU PROVE IT'S LAB MADE. I THINK I JUST DISPROVED MY CORE THESIS. PLEASE SOMEONE WITH MORE EXPERIENCE TELL ME IF I AM RIGHT BECAUSE I THINK I JUST PROVED IT'S ARTIFICIAL THIS IS NOT A FUCKING DRILL!

So little secret: if you check the insert:
/note="derived from Severe acute respiratory syndrome
coronavirus 2 BetaCoV/Wuhan/IVDC-HB-01/2019"
It's specifically a clone of corona protein for attempts at vaccination. Yeah of course it's identical. I'M AN IDIOT.

So, tism aside. What do we find? Myroides, Cucumis, a ton of shit. No HIV that's for sure. And no 100%. It's not that weird a sequence. And if you ignore corona and the artificial insert made specifically out of corona, you can see, it's just a small sequence that can be found with relative similarity in plenty of shit. So let's get to insert 2!
Insert 2, genomic boogaloo, code: "CACAAAAACAACAAAAGT" And Whoop! There it is!

INS2 code.jpg


And I am sick of checking numbers anyway, really I was just giving you that for decoration but they're not needed, after this freakout I'm not in the mood, you count base by base if you want. Let's blast that code!

ins2blast.jpg

Oh hey that's hilarious, no need to blastn that shit, even mega got us covered with 100% stuff. Let's see, Canis lupus familiaris! Hah! wow. Digitaria exilis, Lotus japonicus, Coregonus sp, Danaus plexippus plexippus, fuck me all 100 results are filled with shit at 100% confirmation! Yeah let me go ahead and say, that's just an extremely fucking common sequence of base pairs. Like holy shit, it's fucking everywhere. It's equivalent to 6 aminoacids and when putting it online you get a paper separating it 3 by 3 so let me see what that codes for: HKNNKS

Welp all I can find is that it's highly polar with a lot of charged aminoacids, so it's probably some kinda part of a membrane protein. I don't know, all I find is shit about god damned corona-chan. (Praise be unto her.) So if anyone got extra info I'll be happy to hear. Time for instert 3!
Insert 3, why am I still here, just to suffer. "GGT--GATTCTTCTTCAGGT" Hey wait a minute! DASHES? YOU CHEEKY CUNTS! So fun fact, those dashes are there because this was made before the full genome was actually checked, they are base pairs we DON'T KNOW ABOUT. I mean. NOW we do but we didn't at the time of this fucking article. So you're telling me they decided to go ahead and link it despite having 2 bases on a sequence of 20, that is 10% of the god damned sequence, unknown? Nevermind that we know now the full code is: "GGTGATTCTTCTTCAGGT" Wait wat. Alright so my best guess is this is just a formating issue or something. 'cause there ain't no dashes there. Anyone with more experience analyzing this can tell me why they added dashes where there's no point?

1587638498132.png


Anyway let me just erase those dashes and BLAST that shit. And I'm sure you're sick of seeing the extra so let me just put the RID here and go straight for the list:
A2WDW5Z5016 Honestly I should've been doing this from the start but I'm a lazy bastard so I won't redo it just to do it.



And would you look at that another bunch of 100%ers, although less than last time, but including wild bat coronavirus. What's more likely, than the sequence with 100% corroboration with a bat coronavirus comes from the new coronavirus being a bat coronavirus descended from it, or that it is from HIV. An organism that ISN'T EVEN ON THE LIST OF 100% CORROBORATION? Do I even need to explain this shit?
Alrighty then so lets run 1 2 and 3 together through blast. I'll skip the introduction, check this guide https://www.ncbi.nlm.nih.gov/guide/howto/submit-mult-seq-blast/ Blast is really easy to use people, if you got a computer at least, in phone it's hell but that's because phone keyboards suuuuuuck.

Megablast: OH hey it's our old pal the yellow error message!
A2XV4HW0014

blast3 error.jpg


You know the drill. Blastn it is!
A2XYE2B3014

blast3n.jpg


OH HEY! Mus motherfucking musculus! Yeah that's right this shit's more similar to mice than HIV. Fucking bioengineered deathrats! IT'S THE SKAVEN! So point is, nothing even close to 100%. This shit roight here is normal af!
You know the drill. Add 4th sequence get blastin. I'mma ignore the mega cause you know it's gonna yellowscreen. If there's an error with 3 sequences adding a 4th won't change that unless the 4th is huge.
A2YDXYST014

blast4.jpg


And what do you know. It's the same as always. Buncha hits, no HIV.

Alright, so now that we're done explaining the original part. Let's have some fun. First off, let me just straight up get our old girl corona and blast her, straight up, in full. A2ZCDWJ3016

coronablast.jpg


As you can see, she's a coronavirus all right, bat, pangolin, more bat, lotsa sars. You might've noticed the first result is the artificial protein, that's because the protein is a 100% match, despite being shorter, if some other protein were to also be a 100% match, which you'd expect if corona had a synthetic protein inside her, we'd also see it there. But nope. Corona aint got no plastic surgery, she's 100% natural, baby. I mean this doesn't discard synthetic by mutagens so she might be radioactive, but she ain't got no inserts.

So. What did these assholes do? Well quite simply, they ran corona against HIV using blast, then added what they could. Let me replicated it. We go to blast, tick the "run sequences against each other" corona up top, HIV down bottom, megablast it!

A2ZHZF5K114

Well that's awkward, it's our friend yellow error. BLASTN!

MN908947.3

And now if you check that link, you gotta go to the "alignments" tab to find inserts that might be similar. And now that instead of running chunks of corona against HIV like they did before we can finally run ALL of corona against ALL of HIV what do you find? well there is some chunks that are the same. How long are those chunks again? 13 bases, 18 bases, 19/23, 23/29...

Coronavirus has almost 30000 bases. And all it can find, with the laxest fucking protocol, is a few alignments of up to 20 each, and indeed at 19 it seems to get gaps. This is perfectly reasonable through sheer randomness, not to mention how certain sequences simply are found in a lot of stuff, as we've proven above. That's all they did, they ran the whole genome of one against the other and got what they could. Indeed I know that's exactly what they did because if you check their supposed inserts are about as long as mine. This is it people, it's no better than the dumbfuck creatard's wondering why the earth is in a good spot on the solar system. It's pure. fucking. nonesense. And I am sick and god damned tired of idiots with no idea of how genes work quoting these god damned streetshitters on this shit. And in case my prior outburst didn't clue you in I'm not exactly the sharpest tool in the shed so when even I could call bullshit just by looking at the length and lack of any functional reason, you know real scientists must be sick and tired of this display of idiocy.

So in conclusion. I'm an idiot. But I was still right. Corona doesn't have actual artificial HIV inserts. People who say she does are even stupider than I am. Hope you enjoyed the ride. I need coffee.
 
Última edición:
ALLRIGHTY THEN! Ah new day, hearing birds cheep every morning since lockdown was really nice. Pity fuckers decided it was a good time to bring the heavy machinery for maintenance today! I'll miss that.
So, reminder, we're debunking this indian paper: https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1.full which claimed to find 4 sequences common between corona and HIV.

I analized the 4th first because it's on it's own protein according to the paper, namely the HIV-1 Gag protein. And ain't that a coincidence, I also gag whenever I hear this fucking bit of conspiracy. Here's the 4th insert analysis for ya:



So now it's time to analize one two and three, which I wanted to analyze together because, and I quote:

"The amino acid residues of inserts 1, 2 and 3 of 2019-nCoV spike glycoprotein that mapped to HIV-1 were a part of the V4, V5 and V1 domains respectively in gp120 "

So we'll do something special. Namely use the tool to analyze multiple inserts simultaneously, because if I am gonna take the time and autism to analyze this shit, I might as well dance on the god damned grave! Also, since you asked for it. I'll also analyze all 4 of them together, just for the hell of it. But first some structure. First I will post the code of the insert, since the original paper only gives it on the images for some reason. Next I will put the screencap of it on the original genome, namely on this link: https://www.ncbi.nlm.nih.gov/nuccore/MN908947 so you can see it is indeed there. This also gives me the number of the bp, because for some reason the original paper doesn't tell us. More importantly it lets me corroborate that I got the right sequence, so I'll put it throught BLAST. Then I'll put the screenshot of BLAST, first megablast, then blastn (which analyzes for a wider range. Megablast is to find the organism, blastn to find similar sequences. And you also get my comentary because I am hilarious and witty. And that was totally not sarcasm. Alright? Alright!

So, Insert 1 time, that is "GGGACCAATGGTACTAAGAGG" And if we check the genes we get this is from 21776 to 21796.

Ver archivo adjunto 1249505

So let's get crackin' cause this show ain't stoppin'! DROP THAT BLAST!

Ver archivo adjunto 1249508

Oh hey what a surprise the only results of megablast are SARS COV 2. Oh btw WHO, it's SARS-CoV2, not COVID19, GET IT RIGHT! Blastn incoming!
Ver archivo adjunto 1249553
Well that's awkward. 100% confirmation with an artificial spike protein. This one: https://www.ncbi.nlm.nih.gov/nucleo...k&log$=nuclalign&blast_rank=1&RID=A2S0VD1Y016 But that's just a small amount of bases out of the whole damned construct. So let's actually get that protein and BLAST IT!
Ver archivo adjunto 1249527

ALRIGHT SO I FREAKED OUT BECAUSE I'M A MORON. I'mma leave the original rant here so you see how stupid I am. And then let me tell you a little secret:

Holy. mother. of god. And the rest of the 100 results is all versions of SARS-CoV2 too. You can BLAST it yourself if you want. Alright this is where I call everyone (I put here a bunch of users that don't deserve to be harassed by the tons of notifications from every time I edit this shit.) I need reinforcements here! that is a 100% confirmation between the whole genome of an artificial protein and multiple versions of SARS-Cov2, and over 98% for the rest. I'm not joking here this is red fucking alert THIS, THIS IS HOW YOU PROVE IT'S LAB MADE. I THINK I JUST DISPROVED MY CORE THESIS. PLEASE SOMEONE WITH MORE EXPERIENCE TELL ME IF I AM RIGHT BECAUSE I THINK I JUST PROVED IT'S ARTIFICIAL THIS IS NOT A FUCKING DRILL!

So little secret: if you check the insert:
/note="derived from Severe acute respiratory syndrome
coronavirus 2 BetaCoV/Wuhan/IVDC-HB-01/2019"
It's specifically a clone of corona protein for attempts at vaccination. Yeah of course it's identical. I'M AN IDIOT.

So, tism aside. What do we find? Myroides, Cucumis, a ton of shit. No HIV that's for sure. And no 100%. It's not that weird a sequence. And if you ignore corona and the artificial insert made specifically out of corona, you can see, it's just a small sequence that can be found with relative similarity in plenty of shit. So let's get to insert 2!
Insert 2, genomic boogaloo, code: "CACAAAAACAACAAAAGT" And Whoop! There it is!

Ver archivo adjunto 1249559

And I am sick of checking numbers anyway, really I was just giving you that for decoration but they're not needed, after this freakout I'm not in the mood, you count base by base if you want. Let's blast that code!

Ver archivo adjunto 1249608
Oh hey that's hilarious, no need to blastn that shit, even mega got us covered with 100% stuff. Let's see, Canis lupus familiaris! Hah! wow. Digitaria exilis, Lotus japonicus, Coregonus sp, Danaus plexippus plexippus, fuck me all 100 results are filled with shit at 100% confirmation! Yeah let me go ahead and say, that's just an extremely fucking common sequence of base pairs. Like holy shit, it's fucking everywhere. It's equivalent to 6 aminoacids and when putting it online you get a paper separating it 3 by 3 so let me see what that codes for: HKNNKS

Welp all I can find is that it's highly polar with a lot of charged aminoacids, so it's probably some kinda part of a membrane protein. I don't know, all I find is shit about god damned corona-chan. (Praise be unto her.) So if anyone got extra info I'll be happy to hear. Time for instert 3!
Insert 3, why am I still here, just to suffer. "GGT--GATTCTTCTTCAGGT" Hey wait a minute! DASHES? YOU CHEEKY CUNTS! So fun fact, those dashes are there because this was made before the full genome was actually checked, they are base pairs we DON'T KNOW ABOUT. I mean. NOW we do but we didn't at the time of this fucking article. So you're telling me they decided to go ahead and link it despite having 2 bases on a sequence of 20, that is 10% of the god damned sequence, unknown? Nevermind that we know now the full code is: "GGTGATTCTTCTTCAGGT" Wait wat. Alright so my best guess is this is just a formating issue or something. 'cause there ain't no dashes there. Anyone with more experience analyzing this can tell me why they added dashes where there's no point?

Ver archivo adjunto 1249585

Anyway let me just erase those dashes and BLAST that shit. And I'm sure you're sick of seeing the extra so let me just put the RID here and go straight for the list:
A2WDW5Z5016 Honestly I should've been doing this from the start but I'm a lazy bastard so I won't redo it just to do it.



And would you look at that another bunch of 100%ers, although less than last time, but including wild bat coronavirus. What's more likely, than the sequence with 100% corroboration with a bat coronavirus comes from the new coronavirus being a bat coronavirus descended from it, or that it is from HIV. An organism that ISN'T EVEN ON THE LIST OF 100% CORROBORATION? Do I even need to explain this shit?
Alrighty then so lets run 1 2 and 3 together through blast. I'll skip the introduction, check this guide https://www.ncbi.nlm.nih.gov/guide/howto/submit-mult-seq-blast/ Blast is really easy to use people, if you got a computer at least, in phone it's hell but that's because phone keyboards suuuuuuck.

Megablast: OH hey it's our old pal the yellow error message!
A2XV4HW0014

Ver archivo adjunto 1249618

You know the drill. Blastn it is!
A2XYE2B3014

Ver archivo adjunto 1249619

OH HEY! Mus motherfucking musculus! Yeah that's right this shit's more similar to mice than HIV. Fucking bioengineered deathrats! IT'S THE SKAVEN! So point is, nothing even close to 100%. This shit roight here is normal af!
You know the drill. Add 4th sequence get blastin. I'mma ignore the mega cause you know it's gonna yellowscreen. If there's an error with 3 sequences adding a 4th won't change that unless the 4th is huge.
A2YDXYST014

Ver archivo adjunto 1249621

And what do you know. It's the same as always. Buncha hits, no HIV.

Alright, so now that we're done explaining the original part. Let's have some fun. First off, let me just straight up get our old girl corona and blast her, straight up, in full. A2ZCDWJ3016

Ver archivo adjunto 1249629

As you can see, she's a coronavirus all right, bat, pangolin, more bat, lotsa sars. You might've noticed the first result is the artificial protein, that's because the protein is a 100% match, despite being shorter, if some other protein were to also be a 100% match, which you'd expect if corona had a synthetic protein inside her, we'd also see it there. But nope. Corona aint got no plastic surgery, she's 100% natural, baby. I mean this doesn't discard synthetic by mutagens so she might be radioactive, but she ain't got no inserts.

So. What did these assholes do? Well quite simply, they ran corona against HIV using blast, then added what they could. Let me replicated it. We go to blast, tick the "run sequences against each other" corona up top, HIV down bottom, megablast it!

A2ZHZF5K114

Well that's awkward, it's our friend yellow error. BLASTN!

MN908947.3

And now if you check that link, you gotta go to the "alignments" tab to find inserts that might be similar. And now that instead of running chunks of corona against HIV like they did before we can finally run ALL of corona against ALL of HIV what do you find? well there is some chunks that are the same. How long are those chunks again? 13 bases, 18 bases, 19/23, 23/29...

Coronavirus has almost 30000 bases. And all it can find, with the laxest fucking protocol, is a few alignments of up to 20 each, and indeed at 19 it seems to get gaps. This is perfectly reasonable through sheer randomness, not to mention how certain sequences simply are found in a lot of stuff, as we've proven above. That's all they did, they ran the whole genome of one against the other and got what they could. Indeed I know that's exactly what they did because if you check their supposed inserts are about as long as mine. This is it people, it's no better than the dumbfuck creatard's wondering why the earth is in a good spot on the solar system. It's pure. fucking. nonesense. And I am sick and god damned tired of idiots with no idea of how genes work quoting these god damned streetshitters on this shit. And in case my prior outburst didn't clue you in I'm not exactly the sharpest tool in the shed so when even I could call bullshit just by looking at the length and lack of any functional reason, you know real scientists must be sick and tired of this display of idiocy.

So in conclusion. I'm an idiot. But I was still right. Corona doesn't have actual artificial HIV inserts. People who say she does are even stupider than I am. Hope you enjoyed the ride. I need coffee.
Just to be that annoying asterisk: the PAPER is debunked.

Interesting to look at the sequences. Is it just me, or does each bit look a little recombinant? Off by a bit, here and there, but lots of repeating patterns.

Would help explain the false positives (and the strep/canus lupus/etc hits). Lots of it's gonna be inert, but scary to think how adaptable this thing could be.
 
Just to be that annoying asterisk: the PAPER is debunked.

Interesting to look at the sequences. Is it just me, or does each bit look a little recombinant? Off by a bit, here and there, but lots of repeating patterns.

Would help explain the false positives (and the strep/canus lupus/etc hits). Lots of it's gonna be inert, but scary to think how adaptable this thing could be.

Not exactly. Take into account the 4 analyzed sequences were markers. More concretely microsatellites. Which are squences of 2 to 6 bp that repeat a variable amount of times, they are very useful in identifying phylogeny which is why we use them as markers. The paper indeed was made before we mapped the genome so all they had was the markers and what could be analyzed near them. Now, since microsatellites are repetitions of sequences of 2 to 6 bp, and there's only 4 types of bp to repeat to begin with, add that to the fact these were of less than 20 bp total length... Yeah you're bound to hit a lot of stuff just randomly. The 2 is the most interesting one to me because it seems to genuinely be 100% in a lot of stuff, I'm guessing that's actually part of some important protein, but outside of that, it's perfectly explained by just "microsatellites work that way". You can get any species you want, blast it against any other and you'll find a bunch more of those on the sequences where they coincide. Well, I should mention use at least 1 virus for that, 'cause if you use 2 eukariotes you'll find a lot more repetition than mere microsatellites, we all have wide amounts of common genes just from normal cellular stuff.
 
Atrás
Top Abajo