- Registrado
- 9 de Oct, 2019
ALLRIGHTY THEN! Ah new day, hearing birds cheep every morning since lockdown was really nice. Pity fuckers decided it was a good time to bring the heavy machinery for maintenance today! I'll miss that.
So, reminder, we're debunking this indian paper: https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1.full which claimed to find 4 sequences common between corona and HIV.
I analized the 4th first because it's on it's own protein according to the paper, namely the HIV-1 Gag protein. And ain't that a coincidence, I also gag whenever I hear this fucking bit of conspiracy. Here's the 4th insert analysis for ya:
Very funny. And the email idiots so far are quoting air, forum posts with no backing, and emails with boomer paswords. But fuck it, you're right, I misremembered which idiot he was BLASTing there, sorry for that one, hell I didn't even remember a non-HIV idiot, either way. I'm fairly sure we did have the HIV shit redebunked here. But I'll BAST it again here myself. Or more concretely I'll blast insert 4. If you want I'll go after the other three later, right now I have to exercize.
So here's the original paper: https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1.full
if you check:
inserts are the parts in black. So paper claims insert 4 is analogous to HIV. That is: "CAGACTAATT CTCCTCGGCG GGCA", alright, first off let's check where it is. If you go to the sequence because their figures are shit:
Ver archivo adjunto 1248223
that's 23592 to 23625, BLAST THAT SHIT, also remember to tell BLAST to ignore SARS-COV2 else it'll just tell you SARS COV2 has 100% analogy. Yes that's even if you use BLAST straight from the ncbi page, it doesn't remember where it comes from like that. Just put those numbers in the range sarscov2 in the specimen and tell it to blast:
Ver archivo adjunto 1248222
Well that's awkward, no relevant sequences at all. Go back and tell it to blastn so it'll check for more shit.
Ver archivo adjunto 1248226
WOULD YOU LOOK AT THAT. 13 (edit: ORGANISMS (God I'm dumb))AND NONE OF THEM ARE HIV. The indians fucked up. Because they're streetshitters. And that's why the non-peer-reviewed paper got assblasted to hell and back as soon as it got peer reviewed. Voila! Every idiot quoting this shit, nobel price or not, can get fucked.
If you want later today I'll blast the other 3. But suffice it to say, it's the same fucking result. THIS SHIT'S BUNK.
So now it's time to analize one two and three, which I wanted to analyze together because, and I quote:
"The amino acid residues of inserts 1, 2 and 3 of 2019-nCoV spike glycoprotein that mapped to HIV-1 were a part of the V4, V5 and V1 domains respectively in gp120 "
So we'll do something special. Namely use the tool to analyze multiple inserts simultaneously, because if I am gonna take the time and autism to analyze this shit, I might as well dance on the god damned grave! Also, since you asked for it. I'll also analyze all 4 of them together, just for the hell of it. But first some structure. First I will post the code of the insert, since the original paper only gives it on the images for some reason. Next I will put the screencap of it on the original genome, namely on this link: https://www.ncbi.nlm.nih.gov/nuccore/MN908947 so you can see it is indeed there. This also gives me the number of the bp, because for some reason the original paper doesn't tell us. More importantly it lets me corroborate that I got the right sequence, so I'll put it throught BLAST. Then I'll put the screenshot of BLAST, first megablast, then blastn (which analyzes for a wider range. Megablast is to find the organism, blastn to find similar sequences. And you also get my comentary because I am hilarious and witty. And that was totally not sarcasm. Alright? Alright!
So, Insert 1 time, that is "GGGACCAATGGTACTAAGAGG" And if we check the genes we get this is from 21776 to 21796.
So let's get crackin' cause this show ain't stoppin'! DROP THAT BLAST!
Oh hey what a surprise the only results of megablast are SARS COV 2. Oh btw WHO, it's SARS-CoV2, not COVID19, GET IT RIGHT! Blastn incoming!
Well that's awkward. 100% confirmation with an artificial spike protein. This one: https://www.ncbi.nlm.nih.gov/nucleo...k&log$=nuclalign&blast_rank=1&RID=A2S0VD1Y016 But that's just a small amount of bases out of the whole damned construct. So let's actually get that protein and BLAST IT!
ALRIGHT SO I FREAKED OUT BECAUSE I'M A MORON. I'mma leave the original rant here so you see how stupid I am. And then let me tell you a little secret:
So little secret: if you check the insert:
/note="derived from Severe acute respiratory syndrome
coronavirus 2 BetaCoV/Wuhan/IVDC-HB-01/2019"
It's specifically a clone of corona protein for attempts at vaccination. Yeah of course it's identical. I'M AN IDIOT.
So, tism aside. What do we find? Myroides, Cucumis, a ton of shit. No HIV that's for sure. And no 100%. It's not that weird a sequence. And if you ignore corona and the artificial insert made specifically out of corona, you can see, it's just a small sequence that can be found with relative similarity in plenty of shit. So let's get to insert 2!
So let's get crackin' cause this show ain't stoppin'! DROP THAT BLAST!
Oh hey what a surprise the only results of megablast are SARS COV 2. Oh btw WHO, it's SARS-CoV2, not COVID19, GET IT RIGHT! Blastn incoming!
Well that's awkward. 100% confirmation with an artificial spike protein. This one: https://www.ncbi.nlm.nih.gov/nucleo...k&log$=nuclalign&blast_rank=1&RID=A2S0VD1Y016 But that's just a small amount of bases out of the whole damned construct. So let's actually get that protein and BLAST IT!
ALRIGHT SO I FREAKED OUT BECAUSE I'M A MORON. I'mma leave the original rant here so you see how stupid I am. And then let me tell you a little secret:
Holy. mother. of god. And the rest of the 100 results is all versions of SARS-CoV2 too. You can BLAST it yourself if you want. Alright this is where I call everyone (I put here a bunch of users that don't deserve to be harassed by the tons of notifications from every time I edit this shit.) I need reinforcements here! that is a 100% confirmation between the whole genome of an artificial protein and multiple versions of SARS-Cov2, and over 98% for the rest. I'm not joking here this is red fucking alert THIS, THIS IS HOW YOU PROVE IT'S LAB MADE. I THINK I JUST DISPROVED MY CORE THESIS. PLEASE SOMEONE WITH MORE EXPERIENCE TELL ME IF I AM RIGHT BECAUSE I THINK I JUST PROVED IT'S ARTIFICIAL THIS IS NOT A FUCKING DRILL!
So little secret: if you check the insert:
/note="derived from Severe acute respiratory syndrome
coronavirus 2 BetaCoV/Wuhan/IVDC-HB-01/2019"
It's specifically a clone of corona protein for attempts at vaccination. Yeah of course it's identical. I'M AN IDIOT.
So, tism aside. What do we find? Myroides, Cucumis, a ton of shit. No HIV that's for sure. And no 100%. It's not that weird a sequence. And if you ignore corona and the artificial insert made specifically out of corona, you can see, it's just a small sequence that can be found with relative similarity in plenty of shit. So let's get to insert 2!
Insert 2, genomic boogaloo, code: "CACAAAAACAACAAAAGT" And Whoop! There it is!
And I am sick of checking numbers anyway, really I was just giving you that for decoration but they're not needed, after this freakout I'm not in the mood, you count base by base if you want. Let's blast that code!
Oh hey that's hilarious, no need to blastn that shit, even mega got us covered with 100% stuff. Let's see, Canis lupus familiaris! Hah! wow. Digitaria exilis, Lotus japonicus, Coregonus sp, Danaus plexippus plexippus, fuck me all 100 results are filled with shit at 100% confirmation! Yeah let me go ahead and say, that's just an extremely fucking common sequence of base pairs. Like holy shit, it's fucking everywhere. It's equivalent to 6 aminoacids and when putting it online you get a paper separating it 3 by 3 so let me see what that codes for: HKNNKS
Welp all I can find is that it's highly polar with a lot of charged aminoacids, so it's probably some kinda part of a membrane protein. I don't know, all I find is shit about god damned corona-chan. (Praise be unto her.) So if anyone got extra info I'll be happy to hear. Time for instert 3!
And I am sick of checking numbers anyway, really I was just giving you that for decoration but they're not needed, after this freakout I'm not in the mood, you count base by base if you want. Let's blast that code!
Oh hey that's hilarious, no need to blastn that shit, even mega got us covered with 100% stuff. Let's see, Canis lupus familiaris! Hah! wow. Digitaria exilis, Lotus japonicus, Coregonus sp, Danaus plexippus plexippus, fuck me all 100 results are filled with shit at 100% confirmation! Yeah let me go ahead and say, that's just an extremely fucking common sequence of base pairs. Like holy shit, it's fucking everywhere. It's equivalent to 6 aminoacids and when putting it online you get a paper separating it 3 by 3 so let me see what that codes for: HKNNKS
Welp all I can find is that it's highly polar with a lot of charged aminoacids, so it's probably some kinda part of a membrane protein. I don't know, all I find is shit about god damned corona-chan. (Praise be unto her.) So if anyone got extra info I'll be happy to hear. Time for instert 3!
Insert 3, why am I still here, just to suffer. "GGT--GATTCTTCTTCAGGT" Hey wait a minute! DASHES? YOU CHEEKY CUNTS! So fun fact, those dashes are there because this was made before the full genome was actually checked, they are base pairs we DON'T KNOW ABOUT. I mean. NOW we do but we didn't at the time of this fucking article. So you're telling me they decided to go ahead and link it despite having 2 bases on a sequence of 20, that is 10% of the god damned sequence, unknown? Nevermind that we know now the full code is: "GGTGATTCTTCTTCAGGT" Wait wat. Alright so my best guess is this is just a formating issue or something. 'cause there ain't no dashes there. Anyone with more experience analyzing this can tell me why they added dashes where there's no point?
Anyway let me just erase those dashes and BLAST that shit. And I'm sure you're sick of seeing the extra so let me just put the RID here and go straight for the list:
A2WDW5Z5016 Honestly I should've been doing this from the start but I'm a lazy bastard so I won't redo it just to do it.
And would you look at that another bunch of 100%ers, although less than last time, but including wild bat coronavirus. What's more likely, than the sequence with 100% corroboration with a bat coronavirus comes from the new coronavirus being a bat coronavirus descended from it, or that it is from HIV. An organism that ISN'T EVEN ON THE LIST OF 100% CORROBORATION? Do I even need to explain this shit?
Anyway let me just erase those dashes and BLAST that shit. And I'm sure you're sick of seeing the extra so let me just put the RID here and go straight for the list:
A2WDW5Z5016 Honestly I should've been doing this from the start but I'm a lazy bastard so I won't redo it just to do it.
And would you look at that another bunch of 100%ers, although less than last time, but including wild bat coronavirus. What's more likely, than the sequence with 100% corroboration with a bat coronavirus comes from the new coronavirus being a bat coronavirus descended from it, or that it is from HIV. An organism that ISN'T EVEN ON THE LIST OF 100% CORROBORATION? Do I even need to explain this shit?
Alrighty then so lets run 1 2 and 3 together through blast. I'll skip the introduction, check this guide https://www.ncbi.nlm.nih.gov/guide/howto/submit-mult-seq-blast/ Blast is really easy to use people, if you got a computer at least, in phone it's hell but that's because phone keyboards suuuuuuck.
Megablast: OH hey it's our old pal the yellow error message!
A2XV4HW0014
You know the drill. Blastn it is!
A2XYE2B3014
OH HEY! Mus motherfucking musculus! Yeah that's right this shit's more similar to mice than HIV. Fucking bioengineered deathrats! IT'S THE SKAVEN! So point is, nothing even close to 100%. This shit roight here is normal af!
Megablast: OH hey it's our old pal the yellow error message!
A2XV4HW0014
You know the drill. Blastn it is!
A2XYE2B3014
OH HEY! Mus motherfucking musculus! Yeah that's right this shit's more similar to mice than HIV. Fucking bioengineered deathrats! IT'S THE SKAVEN! So point is, nothing even close to 100%. This shit roight here is normal af!
You know the drill. Add 4th sequence get blastin. I'mma ignore the mega cause you know it's gonna yellowscreen. If there's an error with 3 sequences adding a 4th won't change that unless the 4th is huge.
A2YDXYST014
And what do you know. It's the same as always. Buncha hits, no HIV.
A2YDXYST014
And what do you know. It's the same as always. Buncha hits, no HIV.
Alright, so now that we're done explaining the original part. Let's have some fun. First off, let me just straight up get our old girl corona and blast her, straight up, in full. A2ZCDWJ3016
As you can see, she's a coronavirus all right, bat, pangolin, more bat, lotsa sars. You might've noticed the first result is the artificial protein, that's because the protein is a 100% match, despite being shorter, if some other protein were to also be a 100% match, which you'd expect if corona had a synthetic protein inside her, we'd also see it there. But nope. Corona aint got no plastic surgery, she's 100% natural, baby. I mean this doesn't discard synthetic by mutagens so she might be radioactive, but she ain't got no inserts.
So. What did these assholes do? Well quite simply, they ran corona against HIV using blast, then added what they could. Let me replicated it. We go to blast, tick the "run sequences against each other" corona up top, HIV down bottom, megablast it!
A2ZHZF5K114
Well that's awkward, it's our friend yellow error. BLASTN!
MN908947.3
And now if you check that link, you gotta go to the "alignments" tab to find inserts that might be similar. And now that instead of running chunks of corona against HIV like they did before we can finally run ALL of corona against ALL of HIV what do you find? well there is some chunks that are the same. How long are those chunks again? 13 bases, 18 bases, 19/23, 23/29...
Coronavirus has almost 30000 bases. And all it can find, with the laxest fucking protocol, is a few alignments of up to 20 each, and indeed at 19 it seems to get gaps. This is perfectly reasonable through sheer randomness, not to mention how certain sequences simply are found in a lot of stuff, as we've proven above. That's all they did, they ran the whole genome of one against the other and got what they could. Indeed I know that's exactly what they did because if you check their supposed inserts are about as long as mine. This is it people, it's no better than the dumbfuck creatard's wondering why the earth is in a good spot on the solar system. It's pure. fucking. nonesense. And I am sick and god damned tired of idiots with no idea of how genes work quoting these god damned streetshitters on this shit. And in case my prior outburst didn't clue you in I'm not exactly the sharpest tool in the shed so when even I could call bullshit just by looking at the length and lack of any functional reason, you know real scientists must be sick and tired of this display of idiocy.
As you can see, she's a coronavirus all right, bat, pangolin, more bat, lotsa sars. You might've noticed the first result is the artificial protein, that's because the protein is a 100% match, despite being shorter, if some other protein were to also be a 100% match, which you'd expect if corona had a synthetic protein inside her, we'd also see it there. But nope. Corona aint got no plastic surgery, she's 100% natural, baby. I mean this doesn't discard synthetic by mutagens so she might be radioactive, but she ain't got no inserts.
So. What did these assholes do? Well quite simply, they ran corona against HIV using blast, then added what they could. Let me replicated it. We go to blast, tick the "run sequences against each other" corona up top, HIV down bottom, megablast it!
A2ZHZF5K114
Well that's awkward, it's our friend yellow error. BLASTN!
MN908947.3
And now if you check that link, you gotta go to the "alignments" tab to find inserts that might be similar. And now that instead of running chunks of corona against HIV like they did before we can finally run ALL of corona against ALL of HIV what do you find? well there is some chunks that are the same. How long are those chunks again? 13 bases, 18 bases, 19/23, 23/29...
Coronavirus has almost 30000 bases. And all it can find, with the laxest fucking protocol, is a few alignments of up to 20 each, and indeed at 19 it seems to get gaps. This is perfectly reasonable through sheer randomness, not to mention how certain sequences simply are found in a lot of stuff, as we've proven above. That's all they did, they ran the whole genome of one against the other and got what they could. Indeed I know that's exactly what they did because if you check their supposed inserts are about as long as mine. This is it people, it's no better than the dumbfuck creatard's wondering why the earth is in a good spot on the solar system. It's pure. fucking. nonesense. And I am sick and god damned tired of idiots with no idea of how genes work quoting these god damned streetshitters on this shit. And in case my prior outburst didn't clue you in I'm not exactly the sharpest tool in the shed so when even I could call bullshit just by looking at the length and lack of any functional reason, you know real scientists must be sick and tired of this display of idiocy.
So in conclusion. I'm an idiot. But I was still right. Corona doesn't have actual artificial HIV inserts. People who say she does are even stupider than I am. Hope you enjoyed the ride. I need coffee.
Última edición:
