195 - If you see this thread, you must post in it.

  • 🇵🇦 Nuestro primer dominio localizado está en español en kiwifarms.pa. Our first localized domain is on Spanish on kiwifarms.pa.
  • Want to keep track of this thread?
    Accounts can bookmark posts, watch threads for updates, and jump back to where you stopped reading.
    Create account
It’s not difficult to discover your Buddha Mind
But just don’t try to search for it.
Cease accepting and rejecting possible places
Where you think it can be found
And it will appear before you.

Be warned! The slightest exercise of preference
Will open a gulf as wide and deep
as the space between heaven and earth.

If you want to encounter your Buddha Mind
Don’t have opinions about anything.
Opinions produce argument
And contentiousness is a disease of the mind.

Plunge into the depths.
Stillness is deep. There’s nothing profound in shallow waters.
The Buddha Mind is perfect and it encompasses the universe.
It lacks nothing and has nothing in excess.
If you think that you can choose between its parts
You’ll miss its very essence.

Don’t cling to externals, the opposite things,
the things that exist as relative.
Accept them all impartially
And you won’t have to waste time in pointless choosing.

Judgments and discriminations block the flow
and stir the passions.
They roil the mind that needs stillness and peace.
If you go from either-or, this and that,
or any of the countless opposites,
You’ll miss the whole, the One.
Following an opposite you’ll be led astray,
away from the balancing center.
How can you hope to gain the One?

To decide what is, is to determine what’s not.
But determining what’s not can occupy you
so that it becomes what is.
The more you talk and think. the farther away you get.
Cease talking and thinking and you’ll find it everywhere.

If you let all things return to their source, that’s fine.
But if you stop to think that this is your goal
And that this is what success depends upon
And strive and strive instead of simply letting go,
You won’t be doing Zen.
The moment that you start discriminating and preferring
you miss the mark.
Seeking the real is a false view
which should also be abandoned.
Just let go. Cease searching and choosing.
Decisions give rise to confusions
and in confusion where can a mind go?

All the opposing pairs come from the One Great Buddha Mind.
Accept the pairs with gentle resignation.
The Buddha Mind stays calm and still,
Keep your mind within it and nothing can disturb you.
The harmless and the harmful cease to exist.
Subjects when disengaged from their objects vanish
Just as surely as objects,
when disengaged from their subjects, vanish too.
Each depends on the existence of the other.
Understand this duality and you’ll see
that both issue from the Void of the Absolute.

The Ground of all Being contains all the opposites.
From the One, all things originate.
What a waste of time to choose between coarse and fine.
Since the Great Mind gives birth to all things,
Embrace them all and let your prejudices die.

To realize the Great Mind be neither hesitant nor eager.
If you try to grasp it, you’ll cling to air
and fall into the way of heretics.
Where is the Great Dao? Can you lay It down?
Will It stay or go?
Is It not everywhere waiting for you
to unite your nature with Its nature
and become as trouble free as It is?

Don’t tire your mind by worrying about what is real
and what isn’t,
About what to accept and what to reject.
If you want to know the One,
let your senses experience what comes your way,
But don’t be swayed and don’t involve yourself in what comes.
The wise man acts without emotion
and seems not to be acting at all.
The ignorant man lets his emotions get involved.
The wise man knows that all things are part of the One.
The ignorant man sees differences everywhere.

All things are the same at their core
but clinging to one and discarding another
Is living in illusion.
A mind is not a fit judge of itself.
It is prejudiced in its own favor or disfavor.
It cannot see anything objectively.

Bodhi is far beyond all notions of good and evil,
beyond all the pairs of opposites.
Daydreams are illusions and flowers in the sky never bloom.
They are figments of the imagination
and not worth your consideration.
Profit and Loss, right and wrong, coarse and fine.
Let them all go.
Stay awake. Keep your eyes open.
Your daydreams will disappear.
If you do not make judgments, everything will be
exactly as it is supposed to be.

Deep is the Tathagata’s wisdom,
Lofty and beyond all illusions.
This is the One to which all things return
provided you do not separate them,
keeping some and casting others away.
Where can you put them anyway?
All things are within the One.
There is no outside.

The Ultimate has no pattern, no duality,
and is never partial.
Trust in this. Keep your faith strong.
When you lay down all distinctions there’s nothing left
but Mind that is now pure, that radiates wisdom,
and is never tired.

When Mind passes beyond discriminations
Thoughts and feelings cannot plumb its depths.
The state is absolute and free.
There is neither self nor other.
You will be aware only that you are part of the One.
Everything is inside and nothing is outside.

All wise men everywhere understand this.
This knowledge is beyond time, long or short,
This knowledge is eternal. It neither is nor is not.
Everywhere is here and the smallest equals the largest.
Space cannot confine anything.
The largest equals the smallest.
There are no boundaries, no within and without.
What is and what is not are the same,
For what is not is equal to what is.
If you do not awaken to this truth,
do not worry yourself about it.
Just believe that your Buddha Mind is not divided,
That it accepts all without judgment.
Give no thoughts to words and speeches or pretty plans
The eternal has no present, past or future.
 
ythptoc.png
 
GAGTAGTGATTGTGGGCATCGTCTGGAGCTTTGTTATAGTGATCCTTGTCTGTATAAGGATTGTCTTAGTTGGCTGGAGCGTAGGCTGGATTGTCTGGTGTATCGTTGTAAGGATCGTCGGCAGGGGGATTTAACATG
 
If a train leaves a Portland bridge heading east at 45 miles per hour and another train leaves an Orlando nightclub traveling west at 55 miles per hour, how long does it take Shaner to finish masturbating to them?
 
Atrás
Top Abajo