Brianna Wu / John Walker Flynt - "Biggest Victim of Gamergate," Failed Game Developer, Failed Congressional Candidate

Not to mention that Wu's husband is a drug patent lawyer, which I imagine brings in a fat paycheck.


I've been meaning to power level on this one because I think I can bring some insight on Franks actual job and why a biology PhD works in patents.

I have a friend who was a NHS emergency room surgeon but switched jobs to work for one of the big pharma companies.

He described his job as examining the competition's patent filings, to try and ascertain what they were currently developing and how far down the development path they had gone.

He admitted to having taken a small pay cut (NHS surgeons are on a fuckton of money) but he balanced that against working 9-5 Monday-Friday.

could this be what Frank does?
 
CzwYN3MXUAA9Qmv.jpg:large

"I'm not a newfag I've been here all summer!"
 
could this be what Frank does?
Somewhere earlier in the thread, someone posted a few patents that Frank helped work on. Pages and pages of thermonuclear-level autism like "The patented step 3.b.2.iii (a) of the proposed treatment involves administering this DNA snippet: AGGCGATCATATCGTGCTGCAATTCATATC (on for 10 more pages)" I think the reason he gets paid the big bucks is because he can understand the substance of it and has the sheer aspergian patience to slog through it.
 

What the hell is she even talking about? 4chan was way, way more destructive back in the day than it is now.

Sabotage online polls? That's it? No one got hurt? What about the multiple confirmed cases of people being v& for threatening mass shootings, and being the closest thing to a CP honeypot outside of the deep web? Even the comparatively tame antics like Gamergate, the Fappening, and garbage like Jessi Slaughter was more "hurtful" than what comes out of the website now, and that rings true even for the Boogeyman of /pol/.
 
Oh man, I'd love to see John's memory cards from the 90s. They're probably almost as good as CWC's Animal Crossing diaries.

EDIT: However, what he's showing onscreen there isn't it, because I don't think he'd even met the guy he stole the "Brianna" name from in the 90s.

Memory cards Alpha and Beta probably aren't shown because they have "John's Memory Card" written on them.
 
Última edición:
"I am old enough to remember when 4Chan was actually funny...They would do things like sabotage an online poll to name a scientific boat."

That was earlier this year and was leddit, not 4Chan. Boaty McBoatface? Bitch please.
Prospective Congressman John gauges public sentiment by sitting at home and playing vidya on Frank's dime.

Ver archivo adjunto 163481
Ver archivo adjunto 163482
Ver archivo adjunto 163483
That's the redesigned PSOne not a PSX, don't worry though it's an easy mistake to make, it's not like you work in the field...

Oh wait.
 
rebel-png.163376


"the human cost?!"

OK, going full nerd here, but the Rebel Alliance was founded in part because of the Empire's treatment of aliens as second class citizens. Admiral Akbar himself was a slave to Grand Moff Tarkin, which is part of the reason the Mon Calamari came into the Alliance in such huge numbers. The whole point of the Alliance and the New Republic the followed it was equality for all member species, something a proud SJW shit bag like Wu should be expounding on.

Instead of this, Wu makes a sweeping statement meant to sound deep and sympathetic to the Rebel cause and compare it to real life conflicts. What she actually does is further expose the fact that she is only a fan of the franchise to be quirky and nerdy and fit in with the culture she so desperately wants to be part of, and proves that she has zero interest in the well being or treatment of the minorities that she claims to be a champion of.

Fuck off Wu, fuck right off.
Yes, the "human cost" ... of a fictional conflict ... in space.

I think Wu had always trouble to tell reality from fiction.
Prospective Congressman John gauges public sentiment by sitting at home and playing vidya on Frank's dime.

Ver archivo adjunto 163481
Ver archivo adjunto 163482
Ver archivo adjunto 163483
Calls it the greatest shooter ever, writes the name wrong.

Einhänder (german) = one handed sword
 
Aaaand there goes any sort of credibility this rag might've had. Anyone who not only cites John "Brianna" Wu, but also refers to him as a programmer is obviously full of bullshit.

A "computer programmer" (lie) who "heads development" (also a lie) "at a gaming company called Giant Spacekat." (A final lie as the company essentially does not exist and does no development and employs nobody at this point.)
 
How long until Wu starts tweeting about how "from an engineer's point of view, the PSX has an amazing architectural design"?
 
Calling Einhänder the greatest shooter ever made and prioritizing RidgeRacer1&2 over Type 4 would seem completely crazy, but this is someone who unironically thinks FF8 is the best FF. I mean ffs you get Ridge Racer 1&2 on the bonus disc for Type 4 anyway!
 
Eh, plenty of people like playing on the original hardware. Nothing wrong with that.

Shhh, he wouldn't know how to program and install the BIOS needed to play them on a PC, anyway.

And it still doesn't feel the same.

Okay, yeah, it's not the same, but you know Wu isn't doing this because he really wants to play the old games on the old hardware, he's doing this to "geek signal" or whatever.
 
Atrás
Top Abajo